pcm66

· FL · RR PCM, · FL · RR PCM66, · FL · RR PCM66 -TZ, · FL · RR PCM. pCM66 Sequences (2) from Depositor (1). > pCM66 sequence bps gaccctttccgacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaa. NCBI GenBank - Entry ID: Definition: Cloning vector pCM66, complete sequence.; Accession: AF; GI: ; Organism. NCBI GenBank - Entry ID: Definition: Cloning vector pCM66, complete sequence.; Accession: AF; GI: ; Organism. Plasmid pCM66T: trimmed pCM66 backbone from Dr. Mary Lidstrom's lab is published in Unpublished This plasmid is available through Addgene. pCM66 Sequences (2) from Depositor (1). > pCM66 sequence bps gaccctttccgacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaa.

Pcm66 - your real

Download or View Files. By continuing the use this site, you agree to the use of cookies. Mary Lidstrom Lab Plasmids.

Videos

CHINNI ASHA children video album

0 comments